Shutupvitxh3918 Shutupvitxh3918
  • 03-04-2018
  • Social Studies
contestada

A _____ collects and archives learning experiences in the form of statements that can be organized and presented in a meaningful way.

Respuesta :

BAtreides
BAtreides BAtreides
  • 12-04-2018
A Learning Records Store collects and archives learning experiences in the form of statements that can be organized and presented in a meaningful way. It is a structure that allows to organize and collect thought and research in a way that focalized the learning experience and it helps to develop critical thinking and awareness.
Answer Link

Otras preguntas

how would u form a superlative for the adverb widely
In which section of his autobiography does Douglass show deep emotion? A.the expression of his affection for other slaves B. the narration of the first few y
Simplify. (-1/2)(4times)(-2)(7y)(-1) A. –28xy B. –28 C. 28xy D. 27
What does hemostasis mean?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
CAN ANYONE PLEASE HELP WITH MATH? The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the n
3+1/4x greater than 11
How many years does an apple tree live useful?
What was George Washington's nickname?