ganttr27
ganttr27 ganttr27
  • 03-03-2018
  • Chemistry
contestada

Which choice is an example of a consumer? Question 9 options: tree fungi bee sun

Respuesta :

sadiyahaaqilah
sadiyahaaqilah sadiyahaaqilah
  • 03-03-2018
the correct answer is C) Bee, any living thing, such as a bee, cannot make its own food therefor it is a consumer
Answer Link
graheda
graheda graheda
  • 03-03-2018
I think it's C. Bee well u can search it up on google it can give u a better answer
Answer Link

Otras preguntas

A youth ice hockey game has 3 periods that are each 20 minutes long. Colin plays 12 minutes each period. Which ratio shows Colin's playing time compared to the
A pet store currently has a total of 45 cats and dogs. There are 7 more cats than dogs. Find the number of cats and dogs in the store. Write and solve a system
what are the 2 major types of cofactors?
what are 2 points on the graph for 6x-5y=25
in what area of Europe were the majority of warsaw pact countries
Ms Graves gave her class 12 minutes to read. Carrie read 5/1/2 pages in that time. At what rate, in the pages per hour, did Carrie read?
The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
The section of the small intestine between the duodenum and ilium?
in what area of Europe were the majority of warsaw pact countries