jessicagallaghe jessicagallaghe

04-01-2018
History

contestada

Who sets the salary of the president?

A. Senate B. Congress C. Vice President D. Citizens

Respuesta :

Аноним Аноним

04-01-2018

either A or B
is your answer.

Answer Link

alanstabbath alanstabbath

04-01-2018

the answer is B. congress

Answer Link

Otras preguntas

Carbohydrates are an important macronutrient for fueling muscles. during exercise, where can the body obtain carbohydrate?

What was a major effect of the agricultural revolution in the united states during the late 1800's?

will give thanks and brainliest What is an informed opinion? an opinion that you agree with an opinion that you don’t agree with an opinion that can be argued

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

What is the slope of the line that contains the points (10,-3) and (8,-9)?

There are 36 ways two dice can land: six ways for the first die and six ways for the second die. in how many of those ways does at least one of the dice show a

Osmosis is how excess salts that accumulate in cells are transferred to the blood stream so they can be removed from the body. explain how this process works in

punctuated equilibrium definition biology

How was the battle of bunker hill an american success even though it was a british victory?

Why was gerald ford called the "unelected president"?