nicdog78ovqd0f nicdog78ovqd0f
  • 04-09-2017
  • Mathematics
contestada

Factor 70x^4y^2+14xy

Respuesta :

APAgony
APAgony APAgony
  • 04-09-2017
70x^4y^2+14xy
14(5x^4y^2+xy)
14xy(5x^3y+1)

Just keep taking out things that both terms have in common, to find the answer.
Answer Link

Otras preguntas

Name the five transport mechanisms of the cell:
Why was the sinking of the Lusitania important? A. It highlighted British aggression towards neutral shipping. B. It kept the United States out of
What is a sample vs a population
Which of the following statements is true regarding the Central Limit Theorem? The samples are dependent. The sample size is small. The sample mean is not no
Toco el piano _______________ hace dos meses. desde se les por
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Compare or Contrast - Jack London's "War" and Ambrose Bierce's "Horseman in the Sky." DUE TODAY!!!
why is the inner mitochondrial membrane folded
Caleb solved this equation and recorded his work. 7.4x + 4.1(2x − 4) = −2.3(x − 6) − 21.6 1. 7.4x + 8.2x − 16.4 = −2.3x + 13.8 − 21.6 2. 15.6x − 16.4 = −2.3x
How did censorship and propaganda help fortify post ww1 dictatorships?