igolds7136 igolds7136
  • 02-05-2017
  • History
contestada

Which World War II event is MOST closely related to Goebbels' statement?

Respuesta :

BlueSky06
BlueSky06 BlueSky06
  • 14-05-2017
The World War II event that is most likely related to the Goebbels' statement would be the "Final Solution." The final solution was considered to be the ultimate procedure that the Nazi Germany would do in order to exterminate the Jews wherein concentration camps were made to cater them.
Answer Link

Otras preguntas

4.2meters= how many centimeter
amy wants to carpet a room that is 12 feet by 8 feet. how many square yards of carpet will she need to complete the room?
Please help with Algebra 1
the bombing of Hiroshima and Nagasaki resulted in
What were the driving forces behind the industrial revolution
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
solve the simultaneous equation 4x+7y=1 3x+10y=15
On Being Brought from Africa to America by Phillis Wheatley 'Twas mercy brought me from my Pagan land, Taught my benighted soul to understand That there's a God
On Being Brought from Africa to America by Phillis Wheatley 'Twas mercy brought me from my Pagan land, Taught my benighted soul to understand That there's a God
a tabletop in the shape a trapezoid has an area of 6550 square centimeters its longer base measures 115 centimeters and the shorter base is 85 centimeters what