tnic2 tnic2
  • 03-04-2017
  • Mathematics
contestada

Solve, 2 more than 0.7 times p equals 2.84

Respuesta :

isa47
isa47 isa47
  • 04-04-2017
0.7p+2=2.84 ---> 0.7p=.84 ---> p=1.2
Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
How did the triple alliance and the triple entente change during the war?
circadian rhythm refers to
Which biomolecule is primarily responsible for providing you with energy?
The area in a multipolar neuron that connects the cell body to the initial segment of the axon is called the ________.
help plz asap !!!!!!!!!!
When a red blood cell is placed in hypertonic (very concentrated) solutions of nacl?
When you prepare to make a left turn from a one-way road into a two-way road, you must:?
If you tell a friend you don't have any money to lend him when in reality you do, you're demonstrating which of the "reasons for lying"?
*The sum of two numbers is 400. If the first number is decreased by 20% and the second number is decreased by 15%, then the sum would be 68 less. Find the numbe