marlonlorenzo123 marlonlorenzo123
  • 02-03-2015
  • Biology
contestada

How do we figure out what the density of something is

Respuesta :

AL2006
AL2006 AL2006
  • 02-03-2015

1).  You measure the mass of the thing.
(If you can weigh it, that information can be used to determine its mass.)

2).  You measure the volume of the thing.

3).  You take the data from the laboratory back to your office. There,
you divide the mass by the volume.  The quotient is the thing's density.


Answer Link

Otras preguntas

Write 3 2/5 as an improper fraction.
Allison traveled a distance of 130 miles in 2 hours. What was Allison's average driving speed
Define1. A paragraph2. Who is a feminist3. Mention 5 qualities of a good paragraph4. Define a Narrative Essay.35 pts​
To rename a worksheet, you change the text on the ? HELP ASAP A. Sheet Columns B. Sheet Header C. Sheet tab
In transduction, the cochlea is part of this structure: and the retina is part of this structure:
how far did this person travel in Section C ( hours 6-7) Remember to include units​
where did hip hop originated and who were its founders?
how old do you have to be to buy non alcoholic beer
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
calculate the molar mass COSO4: _______g/mole