jeslynnrose2006 jeslynnrose2006

01-03-2017
Mathematics

contestada

what is 3 4/6 as a fraction greater than 1

Respuesta :

Julia122116 Julia122116

01-03-2017

Do you want an improper fraction like this 22/6

Answer Link

Аноним Аноним

01-03-2017

It could be 3 2/3 if not wanted as an improper fraction

Answer Link

Otras preguntas

Which of the following excerpts from Fast Food Nation best provides evidence that fast food restaurants are designed for using unskilled labor? Her family’s mo

Virginia is 7-years old. georgia is 14 years old. both girls like to write short stories

What are some examples of dramatic irony in The Hobbit?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

A rectangular garden hasblengtg and width as given by thr expression below length 4-7(3x+4y) eifth 3x(-2y) write a simplifird expression for the perimeter of th

Which graph is a translation of f(x)=x^2, according to the rule: y=(x-2)^2

What does President Lincoln express he did not want to do?

if 2^x-4=4a^x-6 what is the value of a

The temperature on a cloudy night is likely to be __________ those on a clear night all other factors being equal

Solve for x in terms of the other matrices and/or their inverses. x=b+ax