lukea0970
lukea0970 lukea0970
  • 04-03-2022
  • Mathematics
contestada

plsss help i need to know what is 20+60-5

Respuesta :

ntsienimurendwa
ntsienimurendwa ntsienimurendwa
  • 04-03-2022

Answer:

20+60=80

80-5=75

as easy as that

Answer Link

Otras preguntas

which business function is concerned with delivering a product or service to customers?
Can someone help me and explain how I get the answer?
Check the boxes listed with compounds. (More than one box)
Which of the following individuals was the chief of the Yamacraw Indians and allowed James Oglethorpe to establish the settlement of Savannah at Yamacraw Bluff?
How do embargoes impact world trade?
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
A gaseous product of a reaction is collected at 280K and 0.95 atm. Given R = 0.0821L atm what is the molar mass of the gas, in grams per mole, if 5.49 g of gas
Ms. Price has received a 15% raise in salary in each of the last 2 years. If her annual salary this year is $99,000, what was her salary 2 years ago, rounded to
Basic concepts of production??​
which of these receptors is not a membrane receptor?