ninapastra ninapastra

04-02-2022
Biology

contestada

In general, bacterial
cells are prokaryotic.
Which cells are
eukaryotic?
Bacterial cells
Animal and plant cells

Respuesta :

rhea1530 rhea1530

04-02-2022

Animal and plant cells.

Answer Link

Otras preguntas

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

(3-4i)(6i+7)-(2-3i) i need all the work laid out :P pls help this test was due last week! also the answer is 43 - 7i but i need the work <3

i thought of a number, added 4 5 7 to it, and got the number 12 times as big as my original number. what was my number?

Please help Correct answer gets brainliest

What is the slope of the line AB?

pls help im confused D:

A climatologist removes an ice core sample from the Antarctic. She finds volcanic ash at the bottom of the core, followed by increasing amounts of dissolved oxy

I need 2 paragraphs written about anything, even a story. (3 sentence minimum per paragraph.)

Find the value of 7+c when c=18.

What social changes could be used to explain the Salem Witch Trials?