knottscarlie knottscarlie

01-09-2021
Biology

contestada

The muscles are_____ to the skin
medial, distal, proximal, or lateral

Respuesta :

tarasubadis tarasubadis

01-09-2021

Answer:

the muscles are medial to the skin

Answer Link

Otras preguntas

Which of the following was a territory the United States took from Spain after the Spanish–American War? A. Puerto Rico B. Hawaii C. Cuba D.

Vince chooses 3 side dishes from a total of 10 side dishes offered on the menu is how many different ways can he choose

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

The element with the most stable nucleus and smallest mass per particle is

Paul has grades of 86 and 85 on his first two tests. what must he score on his third test in order to have an average of at least 90

Please help me with this one too !!!

Homosociality reflects children's tendency to prefer social interactions with

When Anne begins to think about a boy friend, someone in turn drives her to think about Peter van Daan. Who? Peter Wessel Miep de Jong Harry Goldberg

El clima de la costa Guatemalteca es tropical, es decir es ______________________.

Mrs. Collins is at the table with you and states that the fourth-degree graphs she has seen have four-real zeros. She asks you if it is possible to create a fou