ntandosnethemba2 ntandosnethemba2

01-06-2021
Business

contestada

African marriage is an advantages for men only not women

Respuesta :

kkalkidanbb16 kkalkidanbb16

01-06-2021

Africa is a large and diverse continent, so generalizing such a topic is meaningless.

Answer Link

Otras preguntas

A pp plant is making gametes. how many types of gametes, and in what proportions, will there be

How did the Hellenistic kings spread Greek culture

A major weakness of the new constitution was the bill of rights. a. True b. False

NEED HELP ASAPPPPPPP

235u92 and 238u92 are examples of _____. select one: a. particles of radiation b. allotropes c. tracers d. isotopes

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Find the absolute maximum and minimum values of the function f(x, y) = x2 + xy + y2 on the disc x2 + y2 ≤ 1. (you do not have to use calculus.)

How is parasitism different from commensalism? a. both organisms benefit in parasitism and only one organism benefits in commensalism. b. one organism benefits

please answer this im dying here

You draw two cards from a standard deck of 52 cards, but before you draw the second card, you put the first one back and reshuffle the deck. (a) are the outcome