lisa72 lisa72
  • 01-12-2016
  • Mathematics
contestada

1/6+1/2 simplest form

Respuesta :

xman7373
xman7373 xman7373
  • 01-12-2016
Lowest common denominator-> 6
1/2 multiply both top and bottom by 3 to get it in sixths
1/6+3/6=4/6
4/6 simplifies to 2/3.
2/3 is the simplest form to your question.
Answer Link

Otras preguntas

Description Military time uses 24 hours for the entire day instead of 12 for am/pm separately. Military time is a 4 digit (base-10) integer with the following
Which two phases do the chromosomes exist as chromatin (unraveled form of chromosomes)?
Give an example or describe how WATER QUALITY can be impacted by the Water Cycle in an Aquatic Environment
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
Listen to the sentence and select Juan's profession. A. camarero B. abogado C. científico D. profesor
PLEASE HELP ME!!!!!What is the relationship between mutation, the cell cycle, and cancer? Select all statements that apply. A. Mutated genes typically allow cel
How many grams of water can be made from 6 moles of oxygen
One of the main themes in “The Interlopers” is nature’s indifference to man. Give two pieces of text evidence to support this theme.
Find the product (2y - 6)^2
What’s your favorite book for branliest I’ll go first mine secret garden!!