Edington3843 Edington3843

02-05-2021
Mathematics

contestada

John buys 3 balloons for $4.80 karan buys 4 balloons for $6 how.Much morw.Did john pay per individual balloon.

Respuesta :

hannadragon26 hannadragon26

02-05-2021

John paid $0.10 more per ballon

John
$4.80/3=$1.60 per ballon
Karen
$6/4=$1.50 per ballon
$1.60-$1.50=$0.10

Answer Link

Otras preguntas

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

Am I a good person? And am I popular

I need help finding the value of x.

Which statement does NOT describe a relationship shown in the food web? A Elk are prey for mountain lions. B Mice are herbivores that consume grasses and are p

These are fill in the blanks. 1. When I use line segments to connect the corresponding points of a pre-image and the image in a translation, the line segments a

The machine stops: please help

Numbers Common Mistakes 3x - (-6) = -3

Can someone answer this

Plzzzzzzzz zzz helppppp history There r 2 questions

which of the following is not part of the presidents responsibilities as party leader? A. raise money for the party B. represent the interests of the party C.