iguskamary37 iguskamary37

04-04-2021
Mathematics

contestada

The area of the rectangle shown is 66 m2.
4m
x m
Work out the missing length x.

Respuesta :

JobayerHossain JobayerHossain

04-04-2021

Answer:

16.5 m

Step-by-step explanation:

66÷4=x

x=16.5m

...........

...........

Answer Link

irene1030qi14 irene1030qi14

04-04-2021

The answer is 16.5 because 66/4

Answer Link

Otras preguntas

a club has 5 members. from these members, the positions of president and vice-president have to be filled. how many different ways can these 2 positions be fill

If XY=18, YZ=14, and XZ=20, find the radius of each circle.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

U.s. president woodrow wilson's fourteen points was a proposal based on what post-war principle?

Helppppp how do u do this????

What is the slope of the line that contains the points (10,-3) and (8,-9)?

The national competency-based credential for entry-level early childhood educators is called?

For hundreds of years before India’s independence from Great Britain, Hindus and Muslims had been A.independent B.peaceful C.separate D.hostile

You develop an app to help students complete their homework. To earn money, you sell advertising space on the app’s main screen. An advertiser pays you $25 per

What does President Lincoln express he did not want to do?