lilshortytrin11 lilshortytrin11

04-03-2021
Mathematics

contestada

Write an equation that is equivalent to 1/4 plus 1 plus 3/4 minus 2/3 minus 1/2

Respuesta :

04-03-2021

Answer:1/4 + 1/4 = 1/2 = 0.5

Answer Link

Otras preguntas

Who is largely responsible for the spread of hellenistic culture in the 4th century bc?

can you guys help me with this simple math problem ?

Identify the specific sensory receptors for each of the five common senses.

The _____________________ solved the most difficult problem of the convention, including how the states would be represented in the new congress.

Analysis questions for b.what changes occurred in both forms of the moth over these ten years?

Lucilla wondered what the average weight of each orange was in a five-pound bag of oranges. she purchased six bags and calculated the average weight for a singl

Write a scientific explanation to describe the impact of the infected papaya trees on the toucan population.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Which statement is true about nonfiction? Question 1 options: Nonfiction can contain facts, opinions, and ideas. Nonfiction deals with imaginary people and made

Two factors that determine whether a reaction will occur spontaneously