vibeslol12 vibeslol12

02-03-2021
Mathematics

contestada

(ONLY TWO CAPITAL LETTERS) Please answer correctly !!!!!!!!!! Will mark Brianliest !!!!!!!!!!!!! URGENT

ONLY TWO CAPITAL LETTERS Please answer correctly Will mark Brianliest URGENT class=

Respuesta :

02-03-2021

Answer:

NI and HN

Step-by-step explanation:

The segments are both marked with a congruency mark.

Answer Link

Otras preguntas

Need Help Fast 33 points please Factor x2 + 10x – 18.

Solve for x and y: x-3y=-8 3x+2y=31

what is the smallest unit that can evolve

why is derek miller's social media post different than most?

N general, emerging adulthood is a time during which a person functions physically and psychologically at an optimal level.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

How did world war i and the treaty of versailles contribute to the rise of fascism in the 1920s and 30s?

what are good websites to study for biology?

For some time, the English had little interest in colonizing for what two reasons?

What is the value of [(2/3)^0]^-3