damanda31
damanda31 damanda31
  • 01-11-2016
  • Mathematics
contestada

30 tens minus 3 tens 3 tenths

Respuesta :

763609720
763609720 763609720
  • 01-11-2016
If u want it in numbers, it'll be300-30-0.3 =269.7
Answer Link

Otras preguntas

Which is the reflection line for the transformation shown? x-axis y-axis x = -2 y = -2
The back of a book says it features zombies and suspense. It is most likelyAfantasyBmystery.horror.C HorrorDscience fiction.​
The solubility of aspirin in water is 1 g per 300 mL at 25 degrees celsius. Assuming that your crystallization and washing with water were done at this temperat
Match them to its definition. pls help
Which equation is the inverse of Y equals 2X squared -8
Helllpppp): please !!
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
inverse cosine is used to find to find a given angle measure when we know the ________ and the ______.
Type your response in the box. Tremendous amounts of water flow steadily Over Niagara falls ,which straddles the border of New York and the Canadian province of
Agriculture accounted for more workers in the West than any other occupation. True False