Seudónimo Seudónimo
  • 03-01-2021
  • Mathematics
contestada

#5 Test question 7th grade math

5 Test question 7th grade math class=

Respuesta :

3lite
3lite 3lite
  • 03-01-2021

Answer:

0.85p and p - 0.15p are right

Answer Link

Otras preguntas

Angie takes a random sample of 100 students in her school and finds that 58% of the sample prefers art over music. There are 1,200 students in the school. Based
Please help solve, thanks in advance!
Can someone answer my question plz!!!! It's in the picture and show your work!!!!!
lya took one hour to drive from his apartment to Philips Arena and back. The return drive took 8 minutes less than the trip to the arena. If x represents the ti
Explain why applying a vertical translation and then a horizontal translation produces the same result as applying a horizonatal translation and then a vertical
Jimmy pays $2.93 for each gallon of gas. Which table best represents the relationship between g, the number of gallons purchased, and m, the amount he pays for
Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4
Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What is the additive inverse of -4a