djaquez23 djaquez23

02-12-2020
History

contestada

What the led directly to the creation of the systems shown in the image

Respuesta :

ccamp579 ccamp579

02-12-2020

Answer: we cant answer without seeing the image my dude...

Answer Link

Otras preguntas

Can things of aluminum have a greater mass than things made of iron?

Compared to citizens of other nations, americans are _______ involved in politics and community affairs and vote at ________ levels.

What two molecules are produced by the light reactions and used to power the calvin cycle?

Which constitutional amendment allowed voting for citizens who were eighteen or older?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

One number is 6 more than twice the other number. if the sum of the two numbers is 36, find the two numbers.

Triangle abc has vertices a(0 0) b(6 8) and c(8 4). which equation represents the perpendicular bisector of bc

A tree casts a shadow 32 ft long. at the same time, the shadow cast by a vertical 8-ft post is 4 ft long. find the height of the tree.

A number is increased by 50 percent, then the resulting number is decreased by 40 percent. What is the original number if the final number is eight less than th

what value or values for x make the following inequality true? |x-3|=13 a)11 b)-10 c)-15 d)15