Elimoocoledalazee
Elimoocoledalazee Elimoocoledalazee
  • 01-10-2016
  • Mathematics
contestada

how do you write 82,34,625

Respuesta :

0225044
0225044 0225044
  • 01-10-2016
eight two three four six two five
Answer Link

Otras preguntas

1. Read the paragraph below. When Tyrese dropped his crutches and limped to the starting block, the audience froze. Then the starter’s signal sounded, and the s
Describe the set of data {33, 35, 38, 44, 45, 45, 46, 46, 46, 47}. a. normal distribution c. cannot be determined b. negatively skewed d. positively skewed
Which of the following has 20 faces? A. Tetrahedron B. Dodecahedron C. Octahedron D. Icosahedron
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
We had lunch: sandwiches, potato chips, and iced tea. Carolyn and her mother talked mostly about neighbors and the congregation at the Japanese Methodist Church
Solving this question
4 (2x-6)=10x-6. solve for x
Brainliest to most helpful! Answer asap! The point (−3, 1) is on the terminal side of angle θ, in standard position. What are the values of sine, cosine, and ta
WILL MARK THE BRAINIEST!!!!! A biologist just found a new organism living in the deep ocean and is unsure whether or not to classify it as an animal. Describe t
Explain the significance of the phoenix. what, according to granger, makes humans different from the phoenix?