mdm91sner mdm91sner
  • 01-11-2020
  • Mathematics
contestada

A) Give two negative addends that the sum is -7.9

Respuesta :

arose0346
arose0346 arose0346
  • 01-11-2020
-7 and -.9 are two possible addends
Answer Link
kaylaloll kaylaloll
  • 10-11-2020

Answer:

this is for points sorry

Step-by-step explanation:

Answer Link

Otras preguntas

The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
Which statement accurately describes the significance of the Magna Carta? A. It gave absolute power to the English king over the church and nobility. B.
define concentric circles
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
The type and age of rocks found in the mountain range are also found on another continent. What might this mean?
The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
4.2meters= how many centimeter
Which of the following is the modern counterpart of the journal and diary? a. A magazine article b. A blog c. A speech d. A newspaper article
What is the noun in the sentence below? The fish swims quickly. a. Quickly b. Fish c. The d. Swims
Complete the sentences with seem, look or sound and use like or as if when necessary. 1) Quick! Emma's an the phone. She... she's calling from a long way away.