sonicfanz200
sonicfanz200 sonicfanz200
  • 03-05-2020
  • English
contestada

What are the main differences between Benvolio and Tybalt?

Respuesta :

tiakew03 tiakew03
  • 03-05-2020
Benvolio is calm and thinks more about situations and how to resolve them. Tybalt is very aggressive and likes to jump to the gun about a situation rather than think about consequences
Answer Link

Otras preguntas

A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup
How do I factor polynomials by grouping, step by step? 4x^2 - 19x+ 12
On a new construction site, an electrician can install a new light fixture in 20 minutes. A project calls for 24 new fixtures to be installed on each of 4 floor
what is 15/24 in simplest form
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
how do you know 8 thousandths is less than 1 hundredths
what's the percentage of 1/8 ?
Which of the following is the modern counterpart of the journal and diary? a. A magazine article b. A blog c. A speech d. A newspaper article
Did feudalism create a stable form of government?
A youth ice hockey game has 3 periods that are each 20 minutes long. Colin plays 12 minutes each period. Which ratio shows Colin's playing time compared to the