ashmar1287 ashmar1287
  • 03-05-2020
  • Biology
contestada

what type of grass most likely be used to create a friendly florida yard

Respuesta :

xxinpiecesxxp3c80k
xxinpiecesxxp3c80k xxinpiecesxxp3c80k
  • 03-05-2020
Bermudagrass is the answer to your question
Answer Link
cutetrinibaby cutetrinibaby
  • 03-05-2020
Bermuda grass it’s fast growing and can be tolerant for the cool.
Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
how do you say theatre in Spanish
what's the percentage of 1/8 ?
all 231 students in the math club went on a field trip. some students rode in vans ehich hold 7 students each and some students rode in buses which hold 25 stud
The area of the base of a prism is 50 mm2. The perimeter of the base is 30 mm. The height of the prism is 7 mm. What is the surface area of the prism?
What is the primary purpose of the Supremacy Clause?
COMPARISON; 1. How is concrete like chocolate 2. How is a shirt like a picture 3. how is an elephant like a cloud
Why did we use coin-flipping as a method to choose traits for the parent pets and the offspring pets?
if a star is shown ti be 33.11 trillion killometers away , how many light year would that be