Bellegardebethsaida0 Bellegardebethsaida0

02-04-2020
Mathematics

contestada

The circumference of a circle is 31.4 meters. What is the approximate length of the
radius?

Respuesta :

beckycardenas14 beckycardenas14

02-04-2020

Answer:

r ≈ 5m

Step-by-step explanation:

Answer Link

Otras preguntas

drivers are required to signal a change of direction for at least:

What is the difference of the fractions? Use the number line and equivalent fractions to help find the answer. 다. 1 -2 -2 1 -1 7 0 2 X tiw b - یہ

If a rectangle has a perimeter of 70, a length of x and a width of x-9, find the value of the length of the rectangle A.22 B.4 C.13 D.31

A scientist has 500 mL of a 2.1 M stock solution. She dilutes the solution, and the volume of the solution after the dilution is 3.25 L. What is the molarity (M

bella blooms is a successful business that sells a liquid spray fertilizer to farmers. the fertilizer consists of rich, organic, composted material. recently, n

Which of the following quotations from the story is an example of local color? "It's a hot night. I disremember any sich weather before on the Bar." "Lights mov

How much 10,000J will raise the temperature of 1 liter of water in C

plssss master answerer answer my question

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

a split-brain patient has a picture of a cow flashed to her left hemisphere and that of a fork, to her right hemisphere. she will be able to