jetblackcap jetblackcap
  • 01-04-2019
  • Mathematics
contestada

Please help me out if you can!

Please help me out if you can class=

Respuesta :

shadannamazifard22 shadannamazifard22
  • 01-04-2019

In order for it to be a rectangle all four angels have to be 90 so:

13x+34+10x+10=90

23x=46

X=2

Answer Link

Otras preguntas

How did japan gain territory and control of areas of china during world war 1?
An element's atomic number is 64. How many protons would an atom of this element have?
If o- can give to every other blood type, why cant it recieve other blood types
[xtra points] [urgent] Jim wants to buy two books for $10.00 each. By what percent is the total cost of the two books reduced during the sale?
What are the points of discontinuity? Are they all removable? Please show your work.
What was the main idea of Rousseau's famous work "The Social Contract".
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
PLSSSSSS HELP 30PTSSSSSS!!!!!!!!!!!!!
What value is added to both sides of the equation x2 − 2x = 10 in order to solve by completing the square? A. -1 B. -2 C. 1 D. 2
what's the ph of citric acid