austin23 austin23
  • 01-04-2016
  • Mathematics
contestada

multiplies to -294 but adds to 7

Respuesta :

abbieleigh
abbieleigh abbieleigh
  • 02-04-2016
if you make an xy chart you'll find 21 and -14
Answer Link

Otras preguntas

Jill is interested in understanding the theory that focuses on power in contemporary society. what theory should jill investigate?
Which hormone is essential to our ability to maintain our fluid levels?
what was considered an act of war in 1914?
What did lamarck contribute to the theory of evolution? 101. explain the information that influenced darwin's view of natural selection/ evolution. 102. define
Why does Helen go to bed happy at the end of the chapter?
What is the value of x? x = 2 x = 3 x = 4 x = 6
great Britain is an example of a core nation True or False
which function has the solution set shown in the graph?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
During translation, the mrna is read in groups of three bases. true false