azeroth5550 azeroth5550
  • 02-08-2018
  • Mathematics
contestada

Give the equation for a circle with the given center and radius.
Center at (-10, -4), radius = 5

Respuesta :

Kristiania Kristiania
  • 02-08-2018

The equation of circle can be given as :

(x-h)² +(y-k)²=r²

where (h,k) is center of circle and r is radius

the center is at (-10,-4) and radius =5

so equation becomes,

(x-(-10))² +(y-(-4))²=5²

(x+10)² +(y+4)²=25

Answer Link
vunderkid
vunderkid vunderkid
  • 02-08-2018

The equation of the circle with the center at (-10,-4) and radius 5 is

(x+10)²+(y+4)²=5²

Answer Link

Otras preguntas

the temperature of a sample of matter is a measure of the ?
Did feudalism create a stable form of government?
Which powerful religious group often tried to close the theaters in Shakespeare's time? A. the Puritans B. the King's Men C. the Pilgrims D. the Jacobites
the perimeter of a square 116ft ?
Dalia has just enough money to buy either 6 pears and 20 oranges or 12 oranges and 11 pears. A pear costs $ 0.80. How much does an Orange cost ?
Which word has the long i sound? relieve speciality society social
What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic
What Role Does the Sun Play in Producing Winds And Ocean Currents
What property is shown by the equation? 1. 0 ÷ (–6) = 0
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5