anquangraham28311 anquangraham28311
  • 02-07-2018
  • Physics
contestada

A cone with a mass of 6g has the radius measuring 5cm and a height of 2cm. What is its density?

Respuesta :

AL2006
AL2006 AL2006
  • 02-07-2018
The volume of a cone is (1/3)·(π)·(radius)²·(height) .

For the cone in this problem,

Volume = (1/3) (π) (5 cm)² (2 cm)

Volume = (π/3) (25 cm²) (2 cm)

Volume = 50π/3 cm³ .

Density = (mass) / (volume)

Density = (6g) / (50π cm³/3)

Density = 18/50π g/cm³

Density = 0.115 g/cm³

Answer Link

Otras preguntas

In which section of his autobiography does Douglass show deep emotion? A.the expression of his affection for other slaves B. the narration of the first few y
Write expression using the distributive property to find the product of 7 times 63
how many cups of water should be mixed with 1/4 cup of vinegar to make the cleaning solution?
How many combinations of 5 students can a teacher choose from 24 students? A. 5,100,480 B. 42,504 C. 7,962,624 D. 120
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
The type and age of rocks found in the mountain range are also found on another continent. What might this mean?
the area of a rectangular garden is 38 1/4 square meters. the width of the garden is 4 1/2 meters. find the length of the garden
is a centimeter one tenth or one hundredth or a meter
Graph the six terms of a finite series where a1 = -3 and r = 1.5.
4x-2y=14 y=1/2x-1 Solve the system of linear equations by substitution. Check your answer.