fshol7m8ermar fshol7m8ermar

02-03-2016
Business

contestada

Rate is the percent of interest charged for money loaned.
a. true
b. false

Respuesta :

trixietrix trixietrix

02-03-2016

it has to be b. false :)))

Answer Link

lovemelikeyoudo lovemelikeyoudo

02-03-2016

the rate is the percent of interest charded for a money loan it is false bc rate is not the percent of interest charge on money its a loan

Answer Link

Otras preguntas

Long wavy is it Dominant or recessive i need help

cells and what other concept have in common?

Sunland Company incurs the following costs to produce 11400 units of a subcomponent: Direct materials $9576 Direct labor 12882 Variable overhead 14364 Fixed ove

This cylinder is 6 inches tall & has a volume of 60πin^3. Find the area of the cross section

Can someone explain the steps to me please? I would really appreciate it.

The Yellowstone National Park Food Web Is Shown Below what would be the most likely effect of adding wolves to the park?A. Increased Elk population B. Decrease

The graph that BEST represents the speed of sound relative to the density of the medium it is traveling through is A) A B) B C) C D) D

5. Immediately after a used truck is acquired, a new motor is installed and the tires are replaced at a total cost of $5,750. Is this a capital expenditure or a

Given f(x) = 10 - 2x, find f(7).

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA